Gene coding question [biology]?

The base sequence of the gene coding for a short polypeptide is:


CTACGCTAGGCGATTGACT


What would be the base sequnce of the mRNA transcribed from this gene?Gene coding question [biology]?
For every DNA strand, there is a complementary strand. These two strands are joined together through the base pairs (A - C - G - T).


The bases join in the following way: A joins with T, and C joins with G.


So the complementary DNA strand's base sequence would be:


GATGCGATCCGCTAACTGA.


Then, when mRNA forms it replaces the complementary DNA strand following the same rules of base pairing, except the T is replaced by U, because mRNA lacks T and has U instead.


So, you get:


GAUGCGAUCCGCUAACUCA.


Hope you got it ;)Gene coding question [biology]?
Simple when its T then use A when A then mRna will have U





GAUGCGAUCCGCUAACUGU
assuming this is template DNA, then the gene will be transcribed to RNA. (ATGC, AUGC)





CTACGCTAGGCGATTAGACT (DNA coding strand 5' to 3')





TCGTATCGAATAGCCGAGTC (DNA template 3' to 5')





CGACGCUAGGCGAUUAGACU (mRNA 5' to 3')





mRNA is transcribed from the DNA template, not the DNA coding strand.





it really depends on what you mean by the ';base sequence of the gene coding for the polypeptide.'; Do you mean the coding strand, read in the 5' to 3' direction, like I think you do? If so, then the mRNA transcript answer I gave is correct becuase mRNA is transcribed from the template strand.
For every DNA base sequence we have their opposites purine or pyrimidine i.e. A-T,C-G then


CTACGCTAGGCGATTGACT


GATGCGATCCGCTAACTGA


But for RNA it will be


CUACGCUAGGCGAUUGACU


GAUGCGAUCCGCUAACUGA


Because in RNA thymine is replaced by uracil.
OOH! I love these types of questions!!!!


Now, here's the background information:


For every DNA base sequence, there is an 'opposite'. The opposites are:


A-T, C-G. So, for this sample, which you gave, it would be:


CTACGCTAGGCGATTGACT


GATGCGATCCGCTAACTGA





BUT!! When talking in RNA code, you replace all Ts with Us. SO!


GATGCGATCCGCTAACTGA


would be:


GAUGCGAUCCGCUAACUGA





I hope that answers your question!!!

oil production

cream

medicine cream

oil production

HTML coding?

Can someone out there find me a simple html shop?





I just want to insert a code into my site where people can choose what they want and click submit to send it to me.





Thanks.HTML coding?
To use html to create the form or drop-down menus, I'd suggest looking at this site: http://www.w3schools.com/html/html_forms鈥?/a>





The code required to send the entered or selected data on the other hand is not HTML and is consists of scripting languages such as VB, Java, ASP or PHP for example. Examples like these can also be found at this site: http://www.w3schools.comHTML coding?
That's not HTML. That will need to be XML or javascript.

Layout coding help...?

I'm not that great with coding layouts but I wanted to know how I could make it so that there is the layout, and on the layout's picture there are links you can click. I know it's hard to understand but here is a website that shows what I mean: http://aprilsky.skyward-thoughts.com/ On the layout picture near the bottom there are links that say updates, artwork, etc. I know how to make a layout, I just want to know how to code it like that. If you know how, or have a link that would show me how, thanks in advance.Layout coding help...?
in the link that you provided, what they did what create images that have been mapped with links.


so, you need to do some image mapping.


If you are using a web editing program, it probably has instructions how to do it.


If not, there are tutorials on the web, and now you know what it's called. Here's one link.


http://www.echoecho.com/htmllinks07.htm

Myspace coding question! (picture, typing)?

under my about me i want to put a picture in (which i already know how to do) and then without going to the line under make all my typing rite next to the picture. As in, theres a picture then at the top right next to the picture it says stuff going down down down til it dgoes under then picture. usually i just put the picture code and then type and it only rights one line next to the picture. HELP, THANKS!Myspace coding question! (picture, typing)?
%26lt;img src=';YOURIMAGEURL'; align=';left';%26gt;








then you just type right next to it don't worry about closing this code thats all you needMyspace coding question! (picture, typing)?
maybe try www.myspacejedi.net

PHP coding question?

What is ';Register Globals'; in PHP, and why shouldn't it be used?PHP coding question?
First of all, register globals means that any values submitted to the PHP script either through GET or POST will be assigned as a standard PHP variable. For example if you requested a page test.php?myvariable=1 then your PHP script will automatically load with a variable $myvariable set with the value 1.





If register globals is turned off then the above does not occur and the only way to access the parameters that were sent to the script would be through $_GET, $_POST or $_REQUEST which are defined as associative arrays. So for the previous example you could access the parameter value through $_GET[';myvariable';] or $_REQUEST[';myvariable';]. For you information $_REQUEST combines both $_GET and $_POST.





Turning register globals off promotes good programming practice as the developer should know (in advance) which parameters should be sent to the script, and therefore know what to do with the parameters. This means that there is no problem using $_GET, $_POST and $_REQUEST variables as the programmer knows what they are expecting and can therefore either access the parameter values directly or assign them to a standard php variable if required.





The security issues that may occur by turning register globals on are that the users of your script can assign whatever values they like to any parameter (known or unknown) and these values will be registered in your application. An example of where this could be exploited could be the use of a $logged_in variable, which you may set to either true or false. If a user could guess this variable correctly then they could change the value of this variable by simply adding logged_in=true to the end of the query string. e.g. test.php?username=test%26amp;logged_in=true - which in a poorly implemented application could set the user as ';test'; and make the script believe the user is logged in.





In conclusion, register globals should be turned off in order to promote good programming practices. There is no circumstance where register globals is a neccessity it simply leads to lazy and poor programming practices that will make your code harder to maintain, with the added risks of security breaches.





It is also likely that in a future release of PHP the register globals option will be removed, therefore it is best to write your code to work without this function sooner rather than later.





Hope this helps.PHP coding question?
Register Globals means that all your variables (and its values) can be used across all your pages. It shouldn't be used as turning it on will create a security issue, allow unethical hackers to insert in their own variables which could allow them full access to your codes/database.
It puts everything that you would find in the $_GET and $_POST superglobals are plain old variables.





It allows anyone to add new variables to the page just by editing the URL.





It isn't a problem by itself, but combined with less then very stringent coding practices, it can lead to security holes.
This will explain it better than anybody can....





http://us.php.net/register_globals

Simple coding question !!!!?

how do you link something?Simple coding question !!!!?
Your answer is not specific enough. please edit your question (if you can) to show what language you are talking about. Some languages are: C, C++, C#, Java, Python, Basic, Fortran, Forth, Lisp, Ruby, Perl.Simple coding question !!!!?
what are you linking Java and C++
In general, linking involves a pointer from one data item to another data item, so that you can quickly cross reference from one to the other.

Simple Coding of Hours Worked? (Visual Basic)?

I'm using Visual Basic 2005 Express, and I'm running into a little bit of trouble. I have this so far...





http://img169.imageshack.us/img169/4538/image1ew4.jpg





...and the only thing I want is the program to output the total for the whole week. Simple, so that the user can input hours the employee started, and finished work.





However, I'm having trouble with the whole AM and PM thing. Once I go to 1PM (changing from counting up, to down), my numbers get all messed up since it wouldn't just be counting like in military time, but go along with the 12 hour clock.





I also understand that after a time is entered for ';In-Time'; and ';Out-Time'; for a day, a new value must be created with those hours added up, even though it won't be displayed. And from there, I would take those newly created values, and add them up for the ';Total Hrs.';.





I was thinking about entering defining things such as this...





11AM = ';11';


12PM = ';12';


1PM = ';13';





Not sure though...please help me =(





Thank you if you can!Simple Coding of Hours Worked? (Visual Basic)?
Scrap the text boxes and use drop downs... then there is no room for user error.


1am = 1


12am = 24





then you can use the values from each against an IF statement (if listbox.text.value = ';12AM'; then hourout=24 endif)


take the hourout minus hourin and that equals total hours





sorry... VB6, syntax is probably different for VB 2005 express but the idea is the sameSimple Coding of Hours Worked? (Visual Basic)?
Well AM PM radio buttons for each entry would be a way.





You can ALSO write them in and PARSE, but that presents a problem with 10:30AM because the colon would stop for the VAL() function to obtain a number.





You ARE away of that right, Text Boxes view numbers as characters unless you use the VAL function.





I think your concept of military time is good and maybe you should add a calculator for it or list it on the form





1PM=1300 2PM =1400.





I think listing it is the best way





Then you can VAL the times





920 in


1650 out





Then you subtract using the 60 rule





Boy you're got yourself in a corner





Best way is two fields for each entry





HOURS


9





Minutes


29





Hours


16





Mintues 23





Then you can deal with if mintues =%26gt;60 hours=hours+1 and minutes = minutes-60

oil production

cream

medicine cream

oil production

C++ coding question cin.get()?

i was wondering if i could put like cin.get(y) so it waits for y to be entered. is this possible.C++ coding question cin.get()?
If y is a char, it will only get one char.


If y is a char array, you would need to pass in the number of characters + 1 that you want to get.


If y is a char array, you could also pass in the character that acts as the end of line character.





Here are some web pages that describe how to use cin.get


http://www.cplusplus.com/reference/iostr鈥?/a>


http://www.minich.com/education/wyo/cplu鈥?/a>


http://www.cplusplus.com/forum/general/4鈥?/a>





Hope that helps.C++ coding question cin.get()?
No, that wouldn't be correct syntax.





A normal





cin %26gt;%26gt; y;





will wait for an input before the program continues.





cin.get(y) would mean that ';cin'; is an object of a class, and get() was a function of that class. I mean you could write up a class to do that but it would be rather pointless.
cin object





Standard input stream





cin is an object of class istream that represents the standard input stream. It corresponds to the cstdio stream stdin.





By default, most systems get their standard input from the keyboard, therefore cin is generally expected to get information from the user, although there are many cases where this can be redirected to some other source.





Because cin is an object of class istream, we can retrieve characters from cin either as formatted data using the extraction operator (%26gt;%26gt;) or as unformatted data using the read member function, among others (see istream).





cin is tied (see ios::tie) to the standard output stream cout, which means that cout's buffer is flushed (see ostream::flush) before each i/o operation performed on cin.

HTML Coding Question..?

how do i show an html code without having it in affect.





im making a preview for a myspace layout and i want to give them the code for the layout but how would i give it to them without having it be in affect?HTML Coding Question..?
Use:





%26lt;pre%26gt; [HTML source code] %26lt;/pre%26gt;





Or:





%26lt;textarea%26gt; [HTML source code] %26lt;/textarea%26gt;HTML Coding Question..?
That is not the correct answer. Can't use HTML in textarea tags without de-activating it. Why must people be so quick to think that people know what they are doing in some of these answers when you have a pro coder giving you your answer?





Ron Report Abuse

Guess everyone has been learning from my canned answer to this type question. LOL





How to put HTML code in a textarea or scroll box so it can be copied/pasted:





You MUST deactivate the HTML code by making it appear as text in whichever box you use. The code I show below WILL work as it's been tested.





Change all the opening tag symbols, ';%26lt;';, to the character entity, %26amp; lt ; (without spaces). %26amp; lt ; (without spaces) = %26lt;. This will deactivate the HTML code in the textarea/scroll box, but allow users viewing the page to copy/paste the code.





Example:





%26lt;textarea style=';background: transparent;'; rows=';8'; cols=';70';%26gt; %26amp; lt;img style=';width: XXpx; width: YYpx; border: 0; src';pic link'; alt=';Text Description';%26gt; %26lt;/textarea%26gt; There is no closing tag for the image tag unless you are using an XHTML DocType then the image tag is closed with a space and a ';/';:





Example:





%26amp; lt;img style=';width: XXpx; width: YYpx; border: 0; src';pic


link'; alt=';Text Description'; /%26amp;' gt;





%26amp;' lt; without spaces = %26lt;%26amp;' gt; without spaces = %26gt;





Ron
open notepad or wordpad (preferred) use the replace under edit. Type %26lt; in the find and %26amp; l t ; (no spaces and semicolon at the end) in the replace. Then click replace all. Do the same for %26gt; and %26amp; g t ; (be sure to include semicolon)





In an html page these will display normally but won't affect code. GT stands for greater than and LT stands for less than. These are character symbol codes.
Just convert all your ';%26lt;'; and ';%26gt;'; symbols into html entities. For ';less than'; use %26amp;lt; and for greater than use %26lt;strong%26gt;%26amp;gt;%26lt;/strong%26gt;





An example would be:





%26amp;lt;html%26amp;gt;


%26amp;lt;/head%26amp;gt;


%26amp;lt;title%26amp;gt; My title%26amp;lt;/title%26amp;gt;


%26amp;lt;/head%26amp;gt;


%26amp;lt;body%26amp;gt;


%26amp;lt;p%26amp;gt;


hello :)


%26amp;lt;/p%26amp;gt;


%26amp;lt;/body%26amp;gt;


%26amp;lt;/html%26amp;gt;
You could comment out the code %26lt;!--code goes here--%26gt;

Myspace coding?

ok, so i dont know if this is too hard but ten points will go to the person whos code works. ok, i have a code that makes all text on my profile centered. but i my name is off on my picture. i want a code(if its not too much to ask) that will still keep all of the text on my page centered, but have my name directly centered on my picture.Myspace coding?
you should have a code in your layout that will say





.nametext





and it will have the alignment.


but if you can't find it try putting this at the end of your layout code.





%26lt;style%26gt;


.nametext { text-align: center; }


%26lt;/style%26gt;Myspace coding?
Try putting ';%26lt;div align=center%26gt;'; before the text you want to center, and ';%26lt;/div%26gt;'; after the text you want to center.





Sorry I'm not a myspace person, but this is how you would do it in HTML. Good luck.

Myspace coding?

so i'm on myspace, and i was just wondering....when you are doing special characters...why can't you use ACSII numbers?Myspace coding?
That a good question.Myspace coding?
You can. HTML has it's own form of ascii coding. See the source cited below for a table of values and symbols.
There might be something wrong the code, or MySpaac dont accept ACSII numbers.
Probably becuase someone figured out some way to mess up MySpace by using special codes. I don't know much about this particular topic but I have heard about all kinds of special characters that do weird things to peoples computers and browsers, as well as the sites they're on. People probably started posting these characters in comments on peoples profiles so when you visit it the profile crashes your browser or whatever.

C++ coding question?

I want to divide a rectange with following definition: four numbers (left, bottom, right, top) so that a rectangle that has the bottom-left vertice of (0,0) and right-top of (4,4) would be defined by the numbers, (0 0 4 4). I need to divide it into four quadrants, but can't work out the code to do this...any suggestions? Or ask if you need clarification ........C++ coding question?
The vertices of the four rectangles can be defined as





(left,bottom),(left+(right-left)/2,bot鈥?br>

(right,top),(left+(right-left)/2,botto鈥?br>

(left,top),(left+(right-left)/2,bottom鈥?br>

(right,bottom),(left+(right-left)/2,bo鈥?br>




Hope this will suffice your need.C++ coding question?
Hope this is what you need.





rectangle has: bottom (b), left (l), right (r), top (t);


quadrant 1 (q1) has: bottom1 (b1), left1 (l1), right1 (r1), top1 (t1);


quadrant 2 (q2) has: bottom2 (b2), left2 (l2), right2 (r2), top2 (t2);


and so on.


We have four quadrants:


q3 q4


q1 q2


where:


b1 = b;


l1 = l;


r1 = (r-l)/2;


t1 = (t-b)/2;





b2 = b1;


l2 = r1;


r2 = r;


t2 = t1;





b3 = t1;


l3 = l1;


r3 = r1;


t3 = t;





b4 = t1;


l4 = r1;


r4 = r;


t4 = t;

Myspace Coding Help Please?

I was wondering if any of you guys have the code for hiding the blue bar in general interests, but like leave the general interests..if that makes any sense?





And since I know that probably didn't make sense I just made a picture of what I want hidden.


xD





http://i39.tinypic.com/2q18i0z.png





So does anybody know this code?





Thanks if you do, thanks if you don't :)Myspace Coding Help Please?
%26lt;style%26gt;


.a {hide section titles and inner background color}


table.interestsAndDetails span.lightbluetext8 {display:none;}


.interestsAndDetails td {width:0px;}


table.interestsAndDetails td td {background-color:FFFFFF;}


%26lt;/style%26gt;Myspace Coding Help Please?
i have no idea! i posted a question asking the same thing like 2 minutes ago.. then i saw this.





my friend had a 'hide everything' layout and she says that hers come up without the blue box, but just the writing inside. but im having the same problem as you.

oil production

cream

medicine cream

oil production

HTML Coding question?

I can't center this div with the height, i can't figure out what i'm doing wrong








%26lt;div style=';width: 653px'; align=';center';%26gt;...%26lt;/div%26gt;HTML Coding question?
Almost had it correct:





%26lt;div style=';width: 653px; margin: 0 auto;';%26gt;...%26lt;/div%26gt;





That will center the div container inside whatever container it is in. If you want it a certain height, then add:





height: YYpx;





Vertical centering takes a little more effort.





RonHTML Coding question?
You're welcome.





Ron Report Abuse

Aligning it to the center:





vertically:


%26lt;div style=';margin-top: auto; margin-bottom: auto';%26gt; ....





horizontally:


%26lt;div style=';margin-left: auto; margin-right: auto';%26gt;...
%26lt;div align=';center'; style=';width: 653px; height:100px;'; %26gt;.. Somthing ..%26lt;/div%26gt;
Sigh, my mate would know this problem straight away. I think it's because you haven't got a ';center'; before style or width. But don't quote me on it. I'm quite useless at HTML.
First you type this on the note pad,then copy it and paste it on the front page.Thus you will get.

Sql coding question min/max?

How can I report min max with quantities? I have a column DOB, with the following report:





0 7246


1 90134


2 123776


3 9884313


4 98457441


5 23456372


6 2456787


7 34265


8 8756


9 7894545








how do I get it to return just the 0 and the 9 with their respective quantities? I try coding in the min and max, but those two functions are a little touchy for me.Sql coding question min/max?
Hi, I'm not a SQL pro, but here's how you might get the first and last one, well there are many ways...





Let's call first column col1 et second column col2, the table is table.





SELECT col1, col2 FROM table


ORDER BY col1 ASC // not needed this time if they are inserted in order


LIMIT 0,1


UNION


SELECT col1, col2 FROM table


ORDER BY col1 DESC


LIMIT 0,1;





If the first one will always be col1=0, just change the first select of the union by


SELECT col1, col2 FROM table WHERE col1=0





Good luck!Sql coding question min/max?
select * from YourTable


where DOB in(select min(dob) from YourTable


union all


select max(dob) from YourTable)

Myspace coding..?

i have some avatars i want to put on my page but i want to line three and go down and line three more under the top three like that. but they just stack eachother on my page. can anyone show me a code i can put on the ends to make them line up how i want?





please and thank you.Myspace coding..?
%26lt;br%26gt; skips one line %26lt;br%26gt;%26lt;br%26gt; skips two lines... more %26lt;br%26gt;'s... the more skips lol

Website coding help. (intermediate/advanced)?

I have a site under construction, it will have a mysql database containing stock quantities of a product for sale... how would I include the feature that when an item is bought and stock levels drop that a notification email is sent to the site owner informing of either no stock remaining or low stock levels or simply that an irem has sold?





Would this require php and if so what code should be used?Website coding help. (intermediate/advanced)?
What you need is to look into a thing called PEAR. http://pear.php.net/





You can install a pear module called ';Mail'; and using that module you can send emails out properly using the correct email header types.





Somewhere in your php code, all you have to do is have something like:





if($stock-%26gt;level %26lt;= $minimum_items)


{


/* Mail an email out */


}





The standard php mail function doesn't allow you to do file attachments or what not. The PEAR one does. :)Website coding help. (intermediate/advanced)?
couldnt you jsut use a data base and turn it a webpage. that way you could set up a quiry that will alert the user when new stock is needed to be prdered and thats at gcse lever/a level.
The mail function is usually installed by default - at least on the servers I've used





Just go to PHP.net, and read the mail function in the manual, it's simple enough.
I guess you know php, and you will have the mysql server installed on the machine...





the mysql hooks in php are easy to use... it's just a simple query.
i don;t know abt PHP as im a asp %26amp; asp.net developer try to send a mail on page postback whenever you try to insert a record in the query...
Get some professional help here-





http://tinyurl.com/o5e26

Html coding help ...plz its ver imp.?

can anyone give or provide a link to a site where i can get html coding for 10 web pages...i dont have time to make ... plz help its very imp


coding shuold be of the most basic levelHtml coding help ...plz its ver imp.?
sounds like a home work.





i would love to help you here. but i am sorry .. cant injustice with someone's education.





sorry mate.Html coding help ...plz its ver imp.?
http://www.w3schools.com/htmL/html_intro.asp

HTML coding for facebook.com?

Hey I want to do cool stuff like add a slightly transparent picture to the background of my facebook profile, or add background music, ya know things like that. But I don't know how to locate the HTML for my profile page. Does anyone know where I can find that, or how I can accomplish any of that kind of stuff? PLEASE HELP!!HTML coding for facebook.com?
Unfortunately for you, facebook won't let you do this. Think about how many people had myspace accounts you couldn't read though (yellow background/green text type things). In a way its a good thing facebook blocks this.HTML coding for facebook.com?
Facebook does not allow custom html tagging

oil production

cream

medicine cream

oil production

Cryptography/coding example?

Can someone please give me an example of a coding throughout history and how that code was cracked?





I need to write about a half of a page typed about it, so I need it in simple terms.





Please?Cryptography/coding example?
Go for Julius Caesar's original coding. It uses substitution to change letters according to an alphabet in a grid. Only the sender and the recipient could decode it so the messenger could not disclose any details. Eventually, it was cracked.





Or go for the infamous German Enigma cipher. It has a better history.