Gene coding question [biology]?

The base sequence of the gene coding for a short polypeptide is:


CTACGCTAGGCGATTGACT


What would be the base sequnce of the mRNA transcribed from this gene?Gene coding question [biology]?
For every DNA strand, there is a complementary strand. These two strands are joined together through the base pairs (A - C - G - T).


The bases join in the following way: A joins with T, and C joins with G.


So the complementary DNA strand's base sequence would be:


GATGCGATCCGCTAACTGA.


Then, when mRNA forms it replaces the complementary DNA strand following the same rules of base pairing, except the T is replaced by U, because mRNA lacks T and has U instead.


So, you get:


GAUGCGAUCCGCUAACUCA.


Hope you got it ;)Gene coding question [biology]?
Simple when its T then use A when A then mRna will have U





GAUGCGAUCCGCUAACUGU
assuming this is template DNA, then the gene will be transcribed to RNA. (ATGC, AUGC)





CTACGCTAGGCGATTAGACT (DNA coding strand 5' to 3')





TCGTATCGAATAGCCGAGTC (DNA template 3' to 5')





CGACGCUAGGCGAUUAGACU (mRNA 5' to 3')





mRNA is transcribed from the DNA template, not the DNA coding strand.





it really depends on what you mean by the ';base sequence of the gene coding for the polypeptide.'; Do you mean the coding strand, read in the 5' to 3' direction, like I think you do? If so, then the mRNA transcript answer I gave is correct becuase mRNA is transcribed from the template strand.
For every DNA base sequence we have their opposites purine or pyrimidine i.e. A-T,C-G then


CTACGCTAGGCGATTGACT


GATGCGATCCGCTAACTGA


But for RNA it will be


CUACGCUAGGCGAUUGACU


GAUGCGAUCCGCUAACUGA


Because in RNA thymine is replaced by uracil.
OOH! I love these types of questions!!!!


Now, here's the background information:


For every DNA base sequence, there is an 'opposite'. The opposites are:


A-T, C-G. So, for this sample, which you gave, it would be:


CTACGCTAGGCGATTGACT


GATGCGATCCGCTAACTGA





BUT!! When talking in RNA code, you replace all Ts with Us. SO!


GATGCGATCCGCTAACTGA


would be:


GAUGCGAUCCGCUAACUGA





I hope that answers your question!!!

oil production

cream

medicine cream

oil production

HTML coding?

Can someone out there find me a simple html shop?





I just want to insert a code into my site where people can choose what they want and click submit to send it to me.





Thanks.HTML coding?
To use html to create the form or drop-down menus, I'd suggest looking at this site: http://www.w3schools.com/html/html_forms鈥?/a>





The code required to send the entered or selected data on the other hand is not HTML and is consists of scripting languages such as VB, Java, ASP or PHP for example. Examples like these can also be found at this site: http://www.w3schools.comHTML coding?
That's not HTML. That will need to be XML or javascript.

Layout coding help...?

I'm not that great with coding layouts but I wanted to know how I could make it so that there is the layout, and on the layout's picture there are links you can click. I know it's hard to understand but here is a website that shows what I mean: http://aprilsky.skyward-thoughts.com/ On the layout picture near the bottom there are links that say updates, artwork, etc. I know how to make a layout, I just want to know how to code it like that. If you know how, or have a link that would show me how, thanks in advance.Layout coding help...?
in the link that you provided, what they did what create images that have been mapped with links.


so, you need to do some image mapping.


If you are using a web editing program, it probably has instructions how to do it.


If not, there are tutorials on the web, and now you know what it's called. Here's one link.


http://www.echoecho.com/htmllinks07.htm

Myspace coding question! (picture, typing)?

under my about me i want to put a picture in (which i already know how to do) and then without going to the line under make all my typing rite next to the picture. As in, theres a picture then at the top right next to the picture it says stuff going down down down til it dgoes under then picture. usually i just put the picture code and then type and it only rights one line next to the picture. HELP, THANKS!Myspace coding question! (picture, typing)?
%26lt;img src=';YOURIMAGEURL'; align=';left';%26gt;








then you just type right next to it don't worry about closing this code thats all you needMyspace coding question! (picture, typing)?
maybe try www.myspacejedi.net

PHP coding question?

What is ';Register Globals'; in PHP, and why shouldn't it be used?PHP coding question?
First of all, register globals means that any values submitted to the PHP script either through GET or POST will be assigned as a standard PHP variable. For example if you requested a page test.php?myvariable=1 then your PHP script will automatically load with a variable $myvariable set with the value 1.





If register globals is turned off then the above does not occur and the only way to access the parameters that were sent to the script would be through $_GET, $_POST or $_REQUEST which are defined as associative arrays. So for the previous example you could access the parameter value through $_GET[';myvariable';] or $_REQUEST[';myvariable';]. For you information $_REQUEST combines both $_GET and $_POST.





Turning register globals off promotes good programming practice as the developer should know (in advance) which parameters should be sent to the script, and therefore know what to do with the parameters. This means that there is no problem using $_GET, $_POST and $_REQUEST variables as the programmer knows what they are expecting and can therefore either access the parameter values directly or assign them to a standard php variable if required.





The security issues that may occur by turning register globals on are that the users of your script can assign whatever values they like to any parameter (known or unknown) and these values will be registered in your application. An example of where this could be exploited could be the use of a $logged_in variable, which you may set to either true or false. If a user could guess this variable correctly then they could change the value of this variable by simply adding logged_in=true to the end of the query string. e.g. test.php?username=test%26amp;logged_in=true - which in a poorly implemented application could set the user as ';test'; and make the script believe the user is logged in.





In conclusion, register globals should be turned off in order to promote good programming practices. There is no circumstance where register globals is a neccessity it simply leads to lazy and poor programming practices that will make your code harder to maintain, with the added risks of security breaches.





It is also likely that in a future release of PHP the register globals option will be removed, therefore it is best to write your code to work without this function sooner rather than later.





Hope this helps.PHP coding question?
Register Globals means that all your variables (and its values) can be used across all your pages. It shouldn't be used as turning it on will create a security issue, allow unethical hackers to insert in their own variables which could allow them full access to your codes/database.
It puts everything that you would find in the $_GET and $_POST superglobals are plain old variables.





It allows anyone to add new variables to the page just by editing the URL.





It isn't a problem by itself, but combined with less then very stringent coding practices, it can lead to security holes.
This will explain it better than anybody can....





http://us.php.net/register_globals

Simple coding question !!!!?

how do you link something?Simple coding question !!!!?
Your answer is not specific enough. please edit your question (if you can) to show what language you are talking about. Some languages are: C, C++, C#, Java, Python, Basic, Fortran, Forth, Lisp, Ruby, Perl.Simple coding question !!!!?
what are you linking Java and C++
In general, linking involves a pointer from one data item to another data item, so that you can quickly cross reference from one to the other.

Simple Coding of Hours Worked? (Visual Basic)?

I'm using Visual Basic 2005 Express, and I'm running into a little bit of trouble. I have this so far...





http://img169.imageshack.us/img169/4538/image1ew4.jpg





...and the only thing I want is the program to output the total for the whole week. Simple, so that the user can input hours the employee started, and finished work.





However, I'm having trouble with the whole AM and PM thing. Once I go to 1PM (changing from counting up, to down), my numbers get all messed up since it wouldn't just be counting like in military time, but go along with the 12 hour clock.





I also understand that after a time is entered for ';In-Time'; and ';Out-Time'; for a day, a new value must be created with those hours added up, even though it won't be displayed. And from there, I would take those newly created values, and add them up for the ';Total Hrs.';.





I was thinking about entering defining things such as this...





11AM = ';11';


12PM = ';12';


1PM = ';13';





Not sure though...please help me =(





Thank you if you can!Simple Coding of Hours Worked? (Visual Basic)?
Scrap the text boxes and use drop downs... then there is no room for user error.


1am = 1


12am = 24





then you can use the values from each against an IF statement (if listbox.text.value = ';12AM'; then hourout=24 endif)


take the hourout minus hourin and that equals total hours





sorry... VB6, syntax is probably different for VB 2005 express but the idea is the sameSimple Coding of Hours Worked? (Visual Basic)?
Well AM PM radio buttons for each entry would be a way.





You can ALSO write them in and PARSE, but that presents a problem with 10:30AM because the colon would stop for the VAL() function to obtain a number.





You ARE away of that right, Text Boxes view numbers as characters unless you use the VAL function.





I think your concept of military time is good and maybe you should add a calculator for it or list it on the form





1PM=1300 2PM =1400.





I think listing it is the best way





Then you can VAL the times





920 in


1650 out





Then you subtract using the 60 rule





Boy you're got yourself in a corner





Best way is two fields for each entry





HOURS


9





Minutes


29





Hours


16





Mintues 23





Then you can deal with if mintues =%26gt;60 hours=hours+1 and minutes = minutes-60

oil production

cream

medicine cream

oil production

C++ coding question cin.get()?

i was wondering if i could put like cin.get(y) so it waits for y to be entered. is this possible.C++ coding question cin.get()?
If y is a char, it will only get one char.


If y is a char array, you would need to pass in the number of characters + 1 that you want to get.


If y is a char array, you could also pass in the character that acts as the end of line character.





Here are some web pages that describe how to use cin.get


http://www.cplusplus.com/reference/iostr鈥?/a>


http://www.minich.com/education/wyo/cplu鈥?/a>


http://www.cplusplus.com/forum/general/4鈥?/a>





Hope that helps.C++ coding question cin.get()?
No, that wouldn't be correct syntax.





A normal





cin %26gt;%26gt; y;





will wait for an input before the program continues.





cin.get(y) would mean that ';cin'; is an object of a class, and get() was a function of that class. I mean you could write up a class to do that but it would be rather pointless.
cin object





Standard input stream





cin is an object of class istream that represents the standard input stream. It corresponds to the cstdio stream stdin.





By default, most systems get their standard input from the keyboard, therefore cin is generally expected to get information from the user, although there are many cases where this can be redirected to some other source.





Because cin is an object of class istream, we can retrieve characters from cin either as formatted data using the extraction operator (%26gt;%26gt;) or as unformatted data using the read member function, among others (see istream).





cin is tied (see ios::tie) to the standard output stream cout, which means that cout's buffer is flushed (see ostream::flush) before each i/o operation performed on cin.

HTML Coding Question..?

how do i show an html code without having it in affect.





im making a preview for a myspace layout and i want to give them the code for the layout but how would i give it to them without having it be in affect?HTML Coding Question..?
Use:





%26lt;pre%26gt; [HTML source code] %26lt;/pre%26gt;





Or:





%26lt;textarea%26gt; [HTML source code] %26lt;/textarea%26gt;HTML Coding Question..?
That is not the correct answer. Can't use HTML in textarea tags without de-activating it. Why must people be so quick to think that people know what they are doing in some of these answers when you have a pro coder giving you your answer?





Ron Report Abuse

Guess everyone has been learning from my canned answer to this type question. LOL





How to put HTML code in a textarea or scroll box so it can be copied/pasted:





You MUST deactivate the HTML code by making it appear as text in whichever box you use. The code I show below WILL work as it's been tested.





Change all the opening tag symbols, ';%26lt;';, to the character entity, %26amp; lt ; (without spaces). %26amp; lt ; (without spaces) = %26lt;. This will deactivate the HTML code in the textarea/scroll box, but allow users viewing the page to copy/paste the code.





Example:





%26lt;textarea style=';background: transparent;'; rows=';8'; cols=';70';%26gt; %26amp; lt;img style=';width: XXpx; width: YYpx; border: 0; src';pic link'; alt=';Text Description';%26gt; %26lt;/textarea%26gt; There is no closing tag for the image tag unless you are using an XHTML DocType then the image tag is closed with a space and a ';/';:





Example:





%26amp; lt;img style=';width: XXpx; width: YYpx; border: 0; src';pic


link'; alt=';Text Description'; /%26amp;' gt;





%26amp;' lt; without spaces = %26lt;%26amp;' gt; without spaces = %26gt;





Ron
open notepad or wordpad (preferred) use the replace under edit. Type %26lt; in the find and %26amp; l t ; (no spaces and semicolon at the end) in the replace. Then click replace all. Do the same for %26gt; and %26amp; g t ; (be sure to include semicolon)





In an html page these will display normally but won't affect code. GT stands for greater than and LT stands for less than. These are character symbol codes.
Just convert all your ';%26lt;'; and ';%26gt;'; symbols into html entities. For ';less than'; use %26amp;lt; and for greater than use %26lt;strong%26gt;%26amp;gt;%26lt;/strong%26gt;





An example would be:





%26amp;lt;html%26amp;gt;


%26amp;lt;/head%26amp;gt;


%26amp;lt;title%26amp;gt; My title%26amp;lt;/title%26amp;gt;


%26amp;lt;/head%26amp;gt;


%26amp;lt;body%26amp;gt;


%26amp;lt;p%26amp;gt;


hello :)


%26amp;lt;/p%26amp;gt;


%26amp;lt;/body%26amp;gt;


%26amp;lt;/html%26amp;gt;
You could comment out the code %26lt;!--code goes here--%26gt;

Myspace coding?

ok, so i dont know if this is too hard but ten points will go to the person whos code works. ok, i have a code that makes all text on my profile centered. but i my name is off on my picture. i want a code(if its not too much to ask) that will still keep all of the text on my page centered, but have my name directly centered on my picture.Myspace coding?
you should have a code in your layout that will say





.nametext





and it will have the alignment.


but if you can't find it try putting this at the end of your layout code.





%26lt;style%26gt;


.nametext { text-align: center; }


%26lt;/style%26gt;Myspace coding?
Try putting ';%26lt;div align=center%26gt;'; before the text you want to center, and ';%26lt;/div%26gt;'; after the text you want to center.





Sorry I'm not a myspace person, but this is how you would do it in HTML. Good luck.

Myspace coding?

so i'm on myspace, and i was just wondering....when you are doing special characters...why can't you use ACSII numbers?Myspace coding?
That a good question.Myspace coding?
You can. HTML has it's own form of ascii coding. See the source cited below for a table of values and symbols.
There might be something wrong the code, or MySpaac dont accept ACSII numbers.
Probably becuase someone figured out some way to mess up MySpace by using special codes. I don't know much about this particular topic but I have heard about all kinds of special characters that do weird things to peoples computers and browsers, as well as the sites they're on. People probably started posting these characters in comments on peoples profiles so when you visit it the profile crashes your browser or whatever.

C++ coding question?

I want to divide a rectange with following definition: four numbers (left, bottom, right, top) so that a rectangle that has the bottom-left vertice of (0,0) and right-top of (4,4) would be defined by the numbers, (0 0 4 4). I need to divide it into four quadrants, but can't work out the code to do this...any suggestions? Or ask if you need clarification ........C++ coding question?
The vertices of the four rectangles can be defined as





(left,bottom),(left+(right-left)/2,bot鈥?br>

(right,top),(left+(right-left)/2,botto鈥?br>

(left,top),(left+(right-left)/2,bottom鈥?br>

(right,bottom),(left+(right-left)/2,bo鈥?br>




Hope this will suffice your need.C++ coding question?
Hope this is what you need.





rectangle has: bottom (b), left (l), right (r), top (t);


quadrant 1 (q1) has: bottom1 (b1), left1 (l1), right1 (r1), top1 (t1);


quadrant 2 (q2) has: bottom2 (b2), left2 (l2), right2 (r2), top2 (t2);


and so on.


We have four quadrants:


q3 q4


q1 q2


where:


b1 = b;


l1 = l;


r1 = (r-l)/2;


t1 = (t-b)/2;





b2 = b1;


l2 = r1;


r2 = r;


t2 = t1;





b3 = t1;


l3 = l1;


r3 = r1;


t3 = t;





b4 = t1;


l4 = r1;


r4 = r;


t4 = t;

Myspace Coding Help Please?

I was wondering if any of you guys have the code for hiding the blue bar in general interests, but like leave the general interests..if that makes any sense?





And since I know that probably didn't make sense I just made a picture of what I want hidden.


xD





http://i39.tinypic.com/2q18i0z.png





So does anybody know this code?





Thanks if you do, thanks if you don't :)Myspace Coding Help Please?
%26lt;style%26gt;


.a {hide section titles and inner background color}


table.interestsAndDetails span.lightbluetext8 {display:none;}


.interestsAndDetails td {width:0px;}


table.interestsAndDetails td td {background-color:FFFFFF;}


%26lt;/style%26gt;Myspace Coding Help Please?
i have no idea! i posted a question asking the same thing like 2 minutes ago.. then i saw this.





my friend had a 'hide everything' layout and she says that hers come up without the blue box, but just the writing inside. but im having the same problem as you.

oil production

cream

medicine cream

oil production

HTML Coding question?

I can't center this div with the height, i can't figure out what i'm doing wrong








%26lt;div style=';width: 653px'; align=';center';%26gt;...%26lt;/div%26gt;HTML Coding question?
Almost had it correct:





%26lt;div style=';width: 653px; margin: 0 auto;';%26gt;...%26lt;/div%26gt;





That will center the div container inside whatever container it is in. If you want it a certain height, then add:





height: YYpx;





Vertical centering takes a little more effort.





RonHTML Coding question?
You're welcome.





Ron Report Abuse

Aligning it to the center:





vertically:


%26lt;div style=';margin-top: auto; margin-bottom: auto';%26gt; ....





horizontally:


%26lt;div style=';margin-left: auto; margin-right: auto';%26gt;...
%26lt;div align=';center'; style=';width: 653px; height:100px;'; %26gt;.. Somthing ..%26lt;/div%26gt;
Sigh, my mate would know this problem straight away. I think it's because you haven't got a ';center'; before style or width. But don't quote me on it. I'm quite useless at HTML.
First you type this on the note pad,then copy it and paste it on the front page.Thus you will get.

Sql coding question min/max?

How can I report min max with quantities? I have a column DOB, with the following report:





0 7246


1 90134


2 123776


3 9884313


4 98457441


5 23456372


6 2456787


7 34265


8 8756


9 7894545








how do I get it to return just the 0 and the 9 with their respective quantities? I try coding in the min and max, but those two functions are a little touchy for me.Sql coding question min/max?
Hi, I'm not a SQL pro, but here's how you might get the first and last one, well there are many ways...





Let's call first column col1 et second column col2, the table is table.





SELECT col1, col2 FROM table


ORDER BY col1 ASC // not needed this time if they are inserted in order


LIMIT 0,1


UNION


SELECT col1, col2 FROM table


ORDER BY col1 DESC


LIMIT 0,1;





If the first one will always be col1=0, just change the first select of the union by


SELECT col1, col2 FROM table WHERE col1=0





Good luck!Sql coding question min/max?
select * from YourTable


where DOB in(select min(dob) from YourTable


union all


select max(dob) from YourTable)

Myspace coding..?

i have some avatars i want to put on my page but i want to line three and go down and line three more under the top three like that. but they just stack eachother on my page. can anyone show me a code i can put on the ends to make them line up how i want?





please and thank you.Myspace coding..?
%26lt;br%26gt; skips one line %26lt;br%26gt;%26lt;br%26gt; skips two lines... more %26lt;br%26gt;'s... the more skips lol

Website coding help. (intermediate/advanced)?

I have a site under construction, it will have a mysql database containing stock quantities of a product for sale... how would I include the feature that when an item is bought and stock levels drop that a notification email is sent to the site owner informing of either no stock remaining or low stock levels or simply that an irem has sold?





Would this require php and if so what code should be used?Website coding help. (intermediate/advanced)?
What you need is to look into a thing called PEAR. http://pear.php.net/





You can install a pear module called ';Mail'; and using that module you can send emails out properly using the correct email header types.





Somewhere in your php code, all you have to do is have something like:





if($stock-%26gt;level %26lt;= $minimum_items)


{


/* Mail an email out */


}





The standard php mail function doesn't allow you to do file attachments or what not. The PEAR one does. :)Website coding help. (intermediate/advanced)?
couldnt you jsut use a data base and turn it a webpage. that way you could set up a quiry that will alert the user when new stock is needed to be prdered and thats at gcse lever/a level.
The mail function is usually installed by default - at least on the servers I've used





Just go to PHP.net, and read the mail function in the manual, it's simple enough.
I guess you know php, and you will have the mysql server installed on the machine...





the mysql hooks in php are easy to use... it's just a simple query.
i don;t know abt PHP as im a asp %26amp; asp.net developer try to send a mail on page postback whenever you try to insert a record in the query...
Get some professional help here-





http://tinyurl.com/o5e26

Html coding help ...plz its ver imp.?

can anyone give or provide a link to a site where i can get html coding for 10 web pages...i dont have time to make ... plz help its very imp


coding shuold be of the most basic levelHtml coding help ...plz its ver imp.?
sounds like a home work.





i would love to help you here. but i am sorry .. cant injustice with someone's education.





sorry mate.Html coding help ...plz its ver imp.?
http://www.w3schools.com/htmL/html_intro.asp

HTML coding for facebook.com?

Hey I want to do cool stuff like add a slightly transparent picture to the background of my facebook profile, or add background music, ya know things like that. But I don't know how to locate the HTML for my profile page. Does anyone know where I can find that, or how I can accomplish any of that kind of stuff? PLEASE HELP!!HTML coding for facebook.com?
Unfortunately for you, facebook won't let you do this. Think about how many people had myspace accounts you couldn't read though (yellow background/green text type things). In a way its a good thing facebook blocks this.HTML coding for facebook.com?
Facebook does not allow custom html tagging

oil production

cream

medicine cream

oil production

Cryptography/coding example?

Can someone please give me an example of a coding throughout history and how that code was cracked?





I need to write about a half of a page typed about it, so I need it in simple terms.





Please?Cryptography/coding example?
Go for Julius Caesar's original coding. It uses substitution to change letters according to an alphabet in a grid. Only the sender and the recipient could decode it so the messenger could not disclose any details. Eventually, it was cracked.





Or go for the infamous German Enigma cipher. It has a better history.

Css coding help and stuff ?

OK i have a free webs website and i have the margin set but when the page loads it take forever for the margin to set it self. I was wondering if there was like a code that would automatically center the page no matter the screen width or anything. If someone could please help me in any way with css coding that would be appreciated. :] BTW here's my site in case you need to see it http://thetwilightcodewebs.comCss coding help and stuff ?
Enclose your contents in a div. Do it like this


body { text-align: center; [...yer other body stuff goes here...] }


#wrapper { margin: 0 auto; text-align: left; [...other wrapper stuff here?...] }





%26lt; html %26gt;


%26lt; head %26gt;


...


%26lt; / head %26gt;


%26lt; body %26gt;


%26lt; div id=';wrapper'; %26gt;


...all yer page stuff goes here...


%26lt; / div %26gt;


%26lt; / body %26gt;


%26lt; / html %26gt;Css coding help and stuff ?
put a %26lt;center%26gt; tags directly after the %26lt;body%26gt; tag and a %26lt;/center%26gt; tag directly before the %26lt;/body%26gt; tag.

Computer coding problem. Please help me!?

Ok. So I downloaded this: http://antifreeze.googlecode.com/





I run it, and it begins to work. This program was built to decompile python coding. It decompiles a document, and then I attempt to decompile something else. A window says, ';CGI exit status 0x1'; And the document never decompiles!!!! What do I do!?Computer coding problem. Please help me!?
It sounds to me like the dll or exe you are trying to decompile has some type of protection on it, preventing it from being decompiled. Either that, or the decompiling program has a bug in it. From what I know, many decompilers are clugy by nature, so there may be nothing you can do.

HTML coding question...what does this mean?? HELP?

I was asked to tell what this means in HTML:


%26lt;i%26gt;


%26lt;u%26gt;


%26lt;b%26gt;





could you please explain this to me?? HELP!!!!!HTML coding question...what does this mean?? HELP?
the ';i'; is italics





the ';u'; is underline





the ';b'; is boldHTML coding question...what does this mean?? HELP?
Well that is a ';TRICK'; question. Because %26lt;i%26gt;,%26lt;u%26gt;,%26lt;b%26gt; means html opening tag for the following elements


%26lt;i%26gt;%26lt;/i%26gt; means Italic


%26lt;u%26gt;%26lt;/u%26gt; means underline


%26lt;b%26gt;%26lt;/b%26gt; means bold.


The %26lt;i%26gt;, %26lt;u%26gt;, %26lt;b%26gt; will not do anything without the closing tags. And to get real good, tell them they are old standards and now fonts are normally styled with CSS now.
The first two answers are right. But just wanted to make a note that those are the start tags ONLY. So anything AFTER that point will be italic, underline, or bold with no end. An end tag is the same but will have a slash like this %26lt;/i%26gt; or %26lt;/u%26gt; or %26lt;/b%26gt;.





%26lt;b%26gt;Bold%26lt;/b%26gt;


%26lt;u%26gt;underline


%26lt;i%26gt;Italic%26lt;/i%26gt;





so in the above example, the word italic would also be underlined because the tag has not been ended.
%26lt;i%26gt; = italicize


%26lt;u%26gt; = underline


%26lt;b%26gt; = bold





They are for text.





EXAMPLE:





%26lt;b%26gt;Hello%26lt;b%26gt; Because of the bold command, hello shows up bold on the decoded webpage. Same with %26lt;u%26gt;, and %26lt;i%26gt;. You put them around the text to make it do what the command is made for.





Hope that helps.
Also note that these may be supplanted by new conventions. For example, %26lt;b%26gt; is replaced by %26lt;strong%26gt; in the new standard (in part to allow text-to-voice converters to adjust appropriately).
%26lt;i%26gt;you text will be italic%26lt;/i%26gt;


%26lt;u%26gt;you text will be underlined%26lt;/u%26gt;


%26lt;b%26gt;you text will be bold%26lt;/b%26gt;

MATLAB coding help?

how would i generate a cosine burst of frequency 2Hz, lasting 5 second in MATLAB. need the code.MATLAB coding help?
T = 5; %duration in seconds


Fs = 44100; %sampling rate


t = 1/Fs:1/Fs:T; %vector of time samples


F = 2; %frequency





signal = cos(2*pi*F*t); %create vector containing burst


plot(t, signal); xlabel('time, sec'), ylabel('cos(t)'); %plot it


soundsc(signal, Fs); %play it through your soundcard





You may want to apply a window too, depending on what you're doing. That's reasonably easy - something like this should do the trick:


signal = hamming(length(t)).' .* cos(2*pi*F*t);MATLAB coding help?
n=0:5T;


T= ??; -- you need to define the sampling rate like say 64


f=2;


w=2*pi*f/T;





X= cos(w*n);





i imagine you'll want a plot so:


plot(n,X)

Billing & Coding - 3 Part ?

1 - Is this job like a receptionist?


2 - I know they are two seperate 'jobs' ... is the pay good for either or both?


3 - Are the opportuinites worth the cost/time it takes to earn a degree/certificate to do this job?Billing %26amp; Coding - 3 Part ?
1-No


2-yes/ depends were you work at.


3-again depend-some people just learn as they go make a good living of of it. Others go to school for it and have a hard time finding a job.





If you think you are good at it go for it!!!! :)

oil production

cream

medicine cream

oil production

Neopets coding--photobucket?

I created a pet page called ';the pixel field'; in Neopets, but now it won't let me do any changes. The photobucket URLs seems to be disallowed. I remembered the ';'; around the URL, but it just disappears when I try to save it. Now I don't know what to do. www.neopets.com/~lolliatia is my page, you can go and check it out.Neopets coding--photobucket?
The quotes always disappear, it doesn't make a difference. The photobucket URLs seem to be working? Is there another problem?

Is flash swf file decompile in html coding??

I want to decompile Shockwave Flash file to HTML coding direct.


is this posible??Is flash swf file decompile in html coding??
Download 'swfobject2.0.js' javascript file and use the built it function to include flash file on it.








with regards,


A Suresh Kumar


http://suresh-mobileweb.blogspot.com

Medical Coding at 17?

I am verii interested on learning this course ;)


Im dying to work as Medical Coding...





anyone has a tip for meee???





Im 17 yrs old, do you ppl think i can do it??? ;)





pls be nice :DMedical Coding at 17?
Well you have to go to college and get an associate's degree to do coding.


Go to your local community college to a program accredited by AHIMA. That's the best way to ensure you get a job. It's a very competitve field, and people with the best certifications or most experience will get the job. Give yourself any advantage possible.


Try getting a job as a file clerk or data imager in your local medical records department to get your foot in the door. Medical Coding at 17?
I believe that one must at least have a high school diploma, however, most coding jobs require graduation from an accredited coding program as well as certification(s) in the field. There are actually not too many jobs for the medical coder (or biller or medical assistant) despite what those private $$ schools proclaim :) The coder must also have a couple years experience doing coding tasks before possibly obtaining such a job.





If still interested in the field, please opt for the more affordable county vo-tech school or community college as long as it's accredited within the industry.





For more information on accredited programs for medical coding: http://www.ahima.org
its a good field and you of course dont deal with blood and needles etc. i would start reading about it on PureMedicalJobs.com and maybe get a book on coding etc. and get your foot in the door if possible good luck

Neopets coding--photobucket?

I created a pet page called ';the pixel field'; in Neopets, but now it won't let me do any changes. The photobucket URLs seems to be disallowed. I remembered the ';'; around the URL, but it just disappears when I try to save it. Now I don't know what to do. www.neopets.com/~lolliatia is my page, you can go and check it out.Neopets coding--photobucket?
The quotes always disappear, it doesn't make a difference. The photobucket URLs seem to be working? Is there another problem?

Is flash swf file decompile in html coding??

I want to decompile Shockwave Flash file to HTML coding direct.


is this posible??Is flash swf file decompile in html coding??
Download 'swfobject2.0.js' javascript file and use the built it function to include flash file on it.








with regards,


A Suresh Kumar


http://suresh-mobileweb.blogspot.com

Medical Coding at 17?

I am verii interested on learning this course ;)


Im dying to work as Medical Coding...





anyone has a tip for meee???





Im 17 yrs old, do you ppl think i can do it??? ;)





pls be nice :DMedical Coding at 17?
Well you have to go to college and get an associate's degree to do coding.


Go to your local community college to a program accredited by AHIMA. That's the best way to ensure you get a job. It's a very competitve field, and people with the best certifications or most experience will get the job. Give yourself any advantage possible.


Try getting a job as a file clerk or data imager in your local medical records department to get your foot in the door. Medical Coding at 17?
I believe that one must at least have a high school diploma, however, most coding jobs require graduation from an accredited coding program as well as certification(s) in the field. There are actually not too many jobs for the medical coder (or biller or medical assistant) despite what those private $$ schools proclaim :) The coder must also have a couple years experience doing coding tasks before possibly obtaining such a job.





If still interested in the field, please opt for the more affordable county vo-tech school or community college as long as it's accredited within the industry.





For more information on accredited programs for medical coding: http://www.ahima.org
its a good field and you of course dont deal with blood and needles etc. i would start reading about it on PureMedicalJobs.com and maybe get a book on coding etc. and get your foot in the door if possible good luck

oil production

cream

medicine cream

oil production

Myspace coding question!!?

hi im doing up my boyfriends music page and i need to know how do i position the comments directly below the top friends? so they are going down the right side. theres a big gap that needs to be filled and i think that would look much better. also any other tips to improve the page wd be appreciated!!








heres the link:


http://profile.myspace.com/index.cfm?fuseaction=user.viewprofile%26amp;friendID=444573028Myspace coding question!!?
If you just want to push your comments over to the right underneath your friends, then just add this to the end of your BIO section using SAFE MODE:





%26lt;table%26gt;%26lt;tr%26gt;%26lt;td class=';text';%26gt;Myspace coding question!!?
use profile 2.0

How good for you is Cod Liver Oil?

I had an aunt who died at 92 years of age. She took a tablespoon of cod liver oil each day. She did not have a wrinkle on her face at age 92.How good for you is Cod Liver Oil?
It does lots for your health.


I have an asthmatic cousin who takes cod liver oil...and it really helps his respiratory system. The results are astounding compared his previous poor health.


I also know that it's good for babies as well. It helps increase and improve their apetite.


It does so much for the health...young and old!How good for you is Cod Liver Oil?
Not sure.......





Tastes so bad I can't get it down.
Awful, but it does the trick when you need to take it.

What game should I get for Christmas Left 4 Dead or COD world at war?

Which game is better?What game should I get for Christmas Left 4 Dead or COD world at war?
The problem with your two games here is that they are under different Categories, One's a FPS War game and the other is more like Action Horror. The new installments to the COD series seem to really have a huge focus on the MP aspects of the game, Like Weapon customization and perks which add replability along with the whole going prestige thing but if you want an honest opinion regarding COD:WaW.... The game Blows when compared to COD4:MW, It is a straight ripoff of COD4:MW. Consider it like a COD:MW WWII Expansion pack.


Now, L4D is also a decent game but it gets repetitive, Once you complete all scenarios all your main focus will most likely be Achievements. It's fun to play with friends, The AI Director is not much but it helps, just places enemies in different areas of the map each time you play and stuff like that. Good Game but it can get old quick, I am an Anti-WWII type of guy but COD:WaW would be the better choice here.What game should I get for Christmas Left 4 Dead or COD world at war?
well i got left 4 dead because i love zombies but i have played world at war and i would think it comes down to how many ww2 games you have played





WAW is an amazing game for another journey back to ww2 times but it is still ww2 with some improvements





left 4 dead is a new idea done really well full of adrenalin pumping moments with clustered gun fights against the living dead and its an amazing amount of fun





so it all comes down to your preferences
COD world at war trust me.
Left for dead!! Cod5 is **** and cod4 is way better so yeah LEFT FOR DEAD
LITTLE BIG PLANET OBIOUSLY I AM GETTIN IT FOR XMAS!!!!!!!!

Coding for character frequency in a string java..pls get me?

If I understood your question well: Here you have one of many solutions:





public class FreqString {


public static void main(String[] args){


String s = ';Guadalajara';;


char[] c = s.toCharArray(); // converting to a char array


int freq =0;


for(int i = 0; i%26lt; c.length;i++) {


if(c[i]=='a') // looking for 'a' only


freq++;


}


System.out.println(';Total chars ';+c.length);


System.out.println(';Number of 'a' are ';+freq);


}


}

How to play the cod 4 zombie mod?

I have been looking and i found some ip adresses but i have no idea what to do. a link would be nice.How to play the cod 4 zombie mod?
there isnt a zombie for cod 4 there is only the zombie mode for cod 5 whihc is world at war so i dont know what ur talking about

Is there anybody out there in the Austin/ Leander area who would like a copy of COD4 or COD WaW?

Both for the Xbox 360, willing to trade for left 4 dead(360), resident evil 5(ps3), and if you have another offer please let me know.Is there anybody out there in the Austin/ Leander area who would like a copy of COD4 or COD WaW?
http://www.tengaged.com/user/Imnotazombi鈥?/a>





im not i love those but the link takes you to someone who does

oil production

cream

medicine cream

oil production

I'm having trouble with flash coding?

I'm working with flash, and im a noob. I got the thing to stop, and I understand it has to go to another scene, I made a whole other scene that has the same exact things, so if you link it, it will seem like it's replaying. But still, HOW DO YOU LINK THE SCENES! or just replay the scene?I'm having trouble with flash coding?
This Class Must Use For Events,


Use it For example for buttom or Image or Form Fields not SCENES

Coding online games?

Anyone know how to code online games?Coding online games?
For online games you could either use Java 2 for creating applets (that run in an internet browser) or C++/VC++. I'm not the best programmer but I have some experience with both. in C++ really all you can make unless your a very high-level programmer is games that run in DOS. Java really is the best programming language for games in general. Most online games are made in Java.

Coding patron library system?

in java proggramingCoding patron library system?
http://en.allexperts.com/q/Java-1046/JAV鈥?/a>





http://www.cs.umd.edu/class/spring2007/c鈥?/a>


http://www.cs101.org/ipij/design

Coding a keygen?

how do people code a keyge, wot programming language do they use?Coding a keygen?
Keygens are programs used to generate codes to register stolen software. As such, answers (and your question itself) is against the community guidelines.Coding a keygen?
They use disassembler to read software algorithm.


if you know software algorithm to check a serial number, then you can reverse the algorithm to create a serial number. that's why they call it 'reverse engineering'.


Most of them use Visual C++, VB and sometimes Java to create keygen. Programming language is not important. the algorithm is.


You can learn how to crack to make a better protection for your software.

Coding Challenge Question? 10pts!!!!!!!?

Which of the following is the anesthesia formula:





a. BTC


b. TBC


c. BTQ


d. BTMCoding Challenge Question? 10pts!!!!!!!?
I'm an anesthesiologist, and well acquainted with billing, but have NO ideal what you're talking about.





We use base units + time units + modifiers, so maybe D?





Weird question.

What is a better game to buy this Christmas, COD 4 or COD waw?

which game is better overall and online?What is a better game to buy this Christmas, COD 4 or COD waw?
waw all the way. its so much betterWhat is a better game to buy this Christmas, COD 4 or COD waw?
well cod4 gamers are moving on past cod4 but cod5 waw is a really good game. beat the game onm any difficulty and you will have un locked a bonus zombie game mode. its a 13 or 12 level game mode it unlocks a co-op mode. but the downside is that it's another ww2 game cod4 was a modern warfare game. so they need to stop[ coming out wit ww2 games and start coming out wit modern warfare games exactley like cod4 not none of frikkin future crap.
the only reason cod4 is ';dying'; is because people having been playing it for almost a year non stop because it is so addicting and good if your going on game play COD 4 is the way to go better guns and its not anotherrr ww2 game its modern warfare..much better
Cod waw has better storyline, and you can play co-op i missions where you cant in Cod4. there is also the minigame Nazi Zombies which is great fun. the multiplayer is the same.


Get Cod WAW
COD Word at War imo i like the multilayer way better then in COD 4 besides the fact that theirs tanks they get annoying sometimes =(
You can go to this website: http://www.aunsoft.com/christmas-games/


There lists 12 Christmas games and you can play them online or download to your PC.
I'd say the people who played cod4 moved on or are moving on to cod5, so if you buy cod4 you're buying a dying game. Wouldn't be worth buying now.
Call of Duty 4 would be the best because of the Present day technology and warfare levels.





Rofl, Call of Duty World at War is pathetic!!!





XD
its a real toss up. most of the people ive asked on line while playing COD 4 have said they hate WAW. its what ever floats your boat cause i like both
COD WAW
COD 4
COD 4
COD WORLD AT WAR ALL DA FREAKIN WAY!!!!!!!!
COD4
COD4
cod waw
World at war is a lot better you should get it.
cod4 bc it has way more things!
i'll say cod 4 is better online, but cod waw is good online too

oil production

cream

medicine cream

oil production

Coding help please!Its urgent!?

I need a php code for this-


when a person on my website gets a message online from another user of my website i want that there will be an email sent automaticaly to the email address of the recipient saying you have a new message fron this guy on this site.





YOu know what i mean,every site has it,like if someone on myspace send you a msg you will bee notifed by mail.Can someone write the code for me?Coding help please!Its urgent!?
Soliciting for any purpose is against the Community Guidelines.





1. Create a simple database program that stores the messages in a MySQL table. Columns for the tables would be to, from, messagedate and messagetext





http://phpeasystep.com/mysql.php





2. Create notification script that sends e-mail after message is stored in database.





http://phpeasystep.com/php-cate.php?cate鈥?/a>Coding help please!Its urgent!?
PHP has a built-in mail() function that allows you to send mail -- see http://www.php.net/mail.





That said, it sounds like you also need some sort of user authentication. This is a far more advanced topic; take a read at http://ca.php.net/session for information about PHP sessions.

Coding for proteins?

which sequences of dna don't code for proteins?Coding for proteins?
On a simple level, non-coding DNA does not code for proteins and only genes code for proteins.





In eukaryotes, such as humans, a large percentage of DNA is non-coding. Some non-coding DNA regulates the activity of coding regions, however much of it has no known function and is therefore referred to as ';junk DNA';





Junk DNA is mostly made up of repetitive elements, such as minisatellites, microsatellites, SINEs (short intersperced elements) and LINEs (long intersperced elements).





In addition to junk DNA, introns don't code for proteins.Coding for proteins?
DNA is a protein that has sequences of genes which act as a roadmap/instruction manual for other proteins to form organs, tissues, etc.


If you're looking for particular gene sequences, you're probably asking this question in the wrong place, unless there are a couple of PhD's from the human genome project hanging around on this site.


Now get back to work on that thesis...LOL
Ok wait...I rethought your question. It sounds like you are referring to introns....the sections of mRNA that are non-coding. They are spliced out so that only exons remain, and these are the sections of mRNA that are transcribed to the protein.
the y is always first

Is ZDF t.v going to broad-cast world cup on Astra without coding?

To my knowledge, yes, but ZDF will show only some of the games. The other half will be shown by ARD, also codefree.