Gene coding question [biology]?

The base sequence of the gene coding for a short polypeptide is:


CTACGCTAGGCGATTGACT


What would be the base sequnce of the mRNA transcribed from this gene?Gene coding question [biology]?
For every DNA strand, there is a complementary strand. These two strands are joined together through the base pairs (A - C - G - T).


The bases join in the following way: A joins with T, and C joins with G.


So the complementary DNA strand's base sequence would be:


GATGCGATCCGCTAACTGA.


Then, when mRNA forms it replaces the complementary DNA strand following the same rules of base pairing, except the T is replaced by U, because mRNA lacks T and has U instead.


So, you get:


GAUGCGAUCCGCUAACUCA.


Hope you got it ;)Gene coding question [biology]?
Simple when its T then use A when A then mRna will have U





GAUGCGAUCCGCUAACUGU
assuming this is template DNA, then the gene will be transcribed to RNA. (ATGC, AUGC)





CTACGCTAGGCGATTAGACT (DNA coding strand 5' to 3')





TCGTATCGAATAGCCGAGTC (DNA template 3' to 5')





CGACGCUAGGCGAUUAGACU (mRNA 5' to 3')





mRNA is transcribed from the DNA template, not the DNA coding strand.





it really depends on what you mean by the ';base sequence of the gene coding for the polypeptide.'; Do you mean the coding strand, read in the 5' to 3' direction, like I think you do? If so, then the mRNA transcript answer I gave is correct becuase mRNA is transcribed from the template strand.
For every DNA base sequence we have their opposites purine or pyrimidine i.e. A-T,C-G then


CTACGCTAGGCGATTGACT


GATGCGATCCGCTAACTGA


But for RNA it will be


CUACGCUAGGCGAUUGACU


GAUGCGAUCCGCUAACUGA


Because in RNA thymine is replaced by uracil.
OOH! I love these types of questions!!!!


Now, here's the background information:


For every DNA base sequence, there is an 'opposite'. The opposites are:


A-T, C-G. So, for this sample, which you gave, it would be:


CTACGCTAGGCGATTGACT


GATGCGATCCGCTAACTGA





BUT!! When talking in RNA code, you replace all Ts with Us. SO!


GATGCGATCCGCTAACTGA


would be:


GAUGCGAUCCGCUAACUGA





I hope that answers your question!!!

oil production

cream

medicine cream

oil production

HTML coding?

Can someone out there find me a simple html shop?





I just want to insert a code into my site where people can choose what they want and click submit to send it to me.





Thanks.HTML coding?
To use html to create the form or drop-down menus, I'd suggest looking at this site: http://www.w3schools.com/html/html_forms鈥?/a>





The code required to send the entered or selected data on the other hand is not HTML and is consists of scripting languages such as VB, Java, ASP or PHP for example. Examples like these can also be found at this site: http://www.w3schools.comHTML coding?
That's not HTML. That will need to be XML or javascript.

Layout coding help...?

I'm not that great with coding layouts but I wanted to know how I could make it so that there is the layout, and on the layout's picture there are links you can click. I know it's hard to understand but here is a website that shows what I mean: http://aprilsky.skyward-thoughts.com/ On the layout picture near the bottom there are links that say updates, artwork, etc. I know how to make a layout, I just want to know how to code it like that. If you know how, or have a link that would show me how, thanks in advance.Layout coding help...?
in the link that you provided, what they did what create images that have been mapped with links.


so, you need to do some image mapping.


If you are using a web editing program, it probably has instructions how to do it.


If not, there are tutorials on the web, and now you know what it's called. Here's one link.


http://www.echoecho.com/htmllinks07.htm

Myspace coding question! (picture, typing)?

under my about me i want to put a picture in (which i already know how to do) and then without going to the line under make all my typing rite next to the picture. As in, theres a picture then at the top right next to the picture it says stuff going down down down til it dgoes under then picture. usually i just put the picture code and then type and it only rights one line next to the picture. HELP, THANKS!Myspace coding question! (picture, typing)?
%26lt;img src=';YOURIMAGEURL'; align=';left';%26gt;








then you just type right next to it don't worry about closing this code thats all you needMyspace coding question! (picture, typing)?
maybe try www.myspacejedi.net

PHP coding question?

What is ';Register Globals'; in PHP, and why shouldn't it be used?PHP coding question?
First of all, register globals means that any values submitted to the PHP script either through GET or POST will be assigned as a standard PHP variable. For example if you requested a page test.php?myvariable=1 then your PHP script will automatically load with a variable $myvariable set with the value 1.





If register globals is turned off then the above does not occur and the only way to access the parameters that were sent to the script would be through $_GET, $_POST or $_REQUEST which are defined as associative arrays. So for the previous example you could access the parameter value through $_GET[';myvariable';] or $_REQUEST[';myvariable';]. For you information $_REQUEST combines both $_GET and $_POST.





Turning register globals off promotes good programming practice as the developer should know (in advance) which parameters should be sent to the script, and therefore know what to do with the parameters. This means that there is no problem using $_GET, $_POST and $_REQUEST variables as the programmer knows what they are expecting and can therefore either access the parameter values directly or assign them to a standard php variable if required.





The security issues that may occur by turning register globals on are that the users of your script can assign whatever values they like to any parameter (known or unknown) and these values will be registered in your application. An example of where this could be exploited could be the use of a $logged_in variable, which you may set to either true or false. If a user could guess this variable correctly then they could change the value of this variable by simply adding logged_in=true to the end of the query string. e.g. test.php?username=test%26amp;logged_in=true - which in a poorly implemented application could set the user as ';test'; and make the script believe the user is logged in.





In conclusion, register globals should be turned off in order to promote good programming practices. There is no circumstance where register globals is a neccessity it simply leads to lazy and poor programming practices that will make your code harder to maintain, with the added risks of security breaches.





It is also likely that in a future release of PHP the register globals option will be removed, therefore it is best to write your code to work without this function sooner rather than later.





Hope this helps.PHP coding question?
Register Globals means that all your variables (and its values) can be used across all your pages. It shouldn't be used as turning it on will create a security issue, allow unethical hackers to insert in their own variables which could allow them full access to your codes/database.
It puts everything that you would find in the $_GET and $_POST superglobals are plain old variables.





It allows anyone to add new variables to the page just by editing the URL.





It isn't a problem by itself, but combined with less then very stringent coding practices, it can lead to security holes.
This will explain it better than anybody can....





http://us.php.net/register_globals

Simple coding question !!!!?

how do you link something?Simple coding question !!!!?
Your answer is not specific enough. please edit your question (if you can) to show what language you are talking about. Some languages are: C, C++, C#, Java, Python, Basic, Fortran, Forth, Lisp, Ruby, Perl.Simple coding question !!!!?
what are you linking Java and C++
In general, linking involves a pointer from one data item to another data item, so that you can quickly cross reference from one to the other.

Simple Coding of Hours Worked? (Visual Basic)?

I'm using Visual Basic 2005 Express, and I'm running into a little bit of trouble. I have this so far...





http://img169.imageshack.us/img169/4538/image1ew4.jpg





...and the only thing I want is the program to output the total for the whole week. Simple, so that the user can input hours the employee started, and finished work.





However, I'm having trouble with the whole AM and PM thing. Once I go to 1PM (changing from counting up, to down), my numbers get all messed up since it wouldn't just be counting like in military time, but go along with the 12 hour clock.





I also understand that after a time is entered for ';In-Time'; and ';Out-Time'; for a day, a new value must be created with those hours added up, even though it won't be displayed. And from there, I would take those newly created values, and add them up for the ';Total Hrs.';.





I was thinking about entering defining things such as this...





11AM = ';11';


12PM = ';12';


1PM = ';13';





Not sure though...please help me =(





Thank you if you can!Simple Coding of Hours Worked? (Visual Basic)?
Scrap the text boxes and use drop downs... then there is no room for user error.


1am = 1


12am = 24





then you can use the values from each against an IF statement (if listbox.text.value = ';12AM'; then hourout=24 endif)


take the hourout minus hourin and that equals total hours





sorry... VB6, syntax is probably different for VB 2005 express but the idea is the sameSimple Coding of Hours Worked? (Visual Basic)?
Well AM PM radio buttons for each entry would be a way.





You can ALSO write them in and PARSE, but that presents a problem with 10:30AM because the colon would stop for the VAL() function to obtain a number.





You ARE away of that right, Text Boxes view numbers as characters unless you use the VAL function.





I think your concept of military time is good and maybe you should add a calculator for it or list it on the form





1PM=1300 2PM =1400.





I think listing it is the best way





Then you can VAL the times





920 in


1650 out





Then you subtract using the 60 rule





Boy you're got yourself in a corner





Best way is two fields for each entry





HOURS


9





Minutes


29





Hours


16





Mintues 23





Then you can deal with if mintues =%26gt;60 hours=hours+1 and minutes = minutes-60

oil production

cream

medicine cream

oil production